MidgeBase gene description page [Pn.11197]
Outline
| Gene ID | Pn.11197 |
| Type | Protein coding gene |
| Scaffold | PnScaf12950 |
| Start | 18 |
| End | 450 |
| Direction | - |
Sequence
Transcript: 285 (bp)
ATGCAAATCTTCGTGAAAACATTAACTGGTAAGACAATCACACTTGAGGTCGAGCCATCAGATACAATTGAGAATGTCAAAGCAAAAATCCAAGACAAGGAGGGAATTCCACCAGACCAACAGCGTTTGATCTTTGCTGGTAAACAACTCGAGGACGGCCGCACATTGAGCGACTACAACATTCAAAAAGAGTCAACGCTTCATTTGGTCCTCCGTCTCCGTGGTGGCCAAGATCCAAGACAAGGAAGGCATTCCTCCAGATCAACAGCGTTTGATCTTCGCTGG
Protein: 95 (aa)
MQIFVKTLTGKTITLEVEPSDTIENVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLRGGQDPRQGRHSSRSTAFDLRW
| Type | Start | End | Length |
| CDS |
21 |
79 |
59 |
| CDS |
163 |
360 |
198 |
| CDS |
423 |
450 |
28 |
| intron |
80 |
162 |
83 |
| intron |
361 |
422 |
62 |
Auto annotation result
| Program/Analysis | Accession | Description | Score/Expectation |
| BLASTP/NCBI-nr |
1YX5 |
Chain B, Solution Structure Of S5a Uim-1UBIQUITIN COMPLEX pdb|1YX6|B Chain B, Solution Structure Of S5a Uim-2UBIQUITIN COMPLEX |
5e-38 |
| InterPro |
IPR019956 |
Ubiquitin subgroup |
|
| InterPro |
IPR019954 |
Ubiquitin conserved site |
|
| InterPro |
IPR000626 |
Ubiquitin |
|
| InterPro |
IPR019955 |
Ubiquitin supergroup |
|
| Gene Ontology(MF) |
GO:0005515 |
protein binding |
|
| Pfam |
PF13881.1 |
Ubiquitin-2 like Rad60 SUMO-like |
0.00033 |
| Pfam |
PF13019.1 |
Telomere stability and silencing |
0.00011 |
| Pfam |
PF00240.18 |
Ubiquitin family |
1e-35 |
| Pfam |
PF08337.7 |
Plexin cytoplasmic RasGAP domain |
0.17 |
| Pfam |
PF10302.4 |
DUF2407 ubiquitin-like domain |
0.012 |
| Pfam |
PF11069.3 |
Protein of unknown function (DUF2870) |
0.047 |
| Pfam |
PF11470.3 |
GLUT4 regulating protein TUG |
0.0076 |
| Pfam |
PF11976.3 |
Ubiquitin-2 like Rad60 SUMO-like |
6.4e-21 |
Expression level (RPKM)
Paralog/Ortholog genes
Paralogous genes
Orthologous genes