MidgeBase gene description page [Pn.06906]
Outline
| Gene ID | Pn.06906 |
| Type | Protein coding gene |
| Scaffold | PnScaf6089 |
| Start | 47568 |
| End | 48214 |
| Direction | - |
Sequence
Transcript: 357 (bp)
ATGACTAGTCCAAGCGCAGGAATTCAACAGTTGCTTGCAGCTGAGAAGAAGGCGGCTGACAAAGTCGGCGAAGCCAGAAAACGCAAGGCAAGAAGACTGAAGCAAGCAAAGGATGAGGCCACTGAAGAAATTGAGAAATATCGCGGTGAGCGTGAGAAGCAATTCAAAGAATTCGAGAACAAGCACGTAGGAAGCAAGGATCAGGTTGCTGCCAAAATCGATGCCGATACCCGAACCAAACTCGACGAGATGAACAGGGCTTTGCAAACGCAAAAGGAACAAGTAATCTACGAGGTTCTTGAATTCATTTATGCCATCAAGCCAGAATTGCACAAAAATTACAAGAATGCTGCAAAG
Protein: 119 (aa)
MTSPSAGIQQLLAAEKKAADKVGEARKRKARRLKQAKDEATEEIEKYRGEREKQFKEFENKHVGSKDQVAAKIDADTRTKLDEMNRALQTQKEQVIYEVLEFIYAIKPELHKNYKNAAK
| Type | Start | End | Length |
| CDS |
47571 |
47744 |
174 |
| CDS |
47800 |
47900 |
101 |
| CDS |
48133 |
48214 |
82 |
| intron |
47745 |
47799 |
55 |
| intron |
47901 |
48132 |
232 |
Auto annotation result
| Program/Analysis | Accession | Description | Score/Expectation |
| BLASTP/NCBI-nr |
EFR19774 |
hypothetical protein AND_30673 [Anopheles darlingi] |
2e-45 |
| InterPro |
IPR005124 |
Vacuolar (H+)-ATPase G subunit |
|
| Gene Ontology(BP) |
GO:0015992 |
proton transport |
|
| Gene Ontology(CC) |
GO:0016471 |
vacuolar proton-transporting V-type ATPase complex |
|
| Gene Ontology(MF) |
GO:0016820 |
hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances |
|
| Pfam |
PF03038.9 |
UL95 family |
0.27 |
| Pfam |
PF01468.12 |
GA module |
0.25 |
| Pfam |
PF05008.10 |
Vesicle transport v-SNARE protein N-terminus |
1.9 |
| Pfam |
PF05957.8 |
Bacterial protein of unknown function (DUF883) |
6.7 |
| Pfam |
PF03179.10 |
Vacuolar (H+)-ATPase G subunit |
2.5e-35 |
| Pfam |
PF01765.14 |
Ribosome recycling factor |
3.7 |
| Pfam |
PF04871.8 |
Uso1 / p115 like vesicle tethering protein, C terminal region |
3.1 |
| Pfam |
PF00430.13 |
ATP synthase B/B' CF(0) |
2.8 |
| Pfam |
PF12072.3 |
Domain of unknown function (DUF3552) |
3.1 |
| Pfam |
PF11068.3 |
Protein of unknown function (DUF2869) |
1.4 |
| Pfam |
PF02601.10 |
Exonuclease VII, large subunit |
0.48 |
Expression level (RPKM)
Paralog/Ortholog genes
Paralogous genes
Orthologous genes
| Species |
Gene ID |
| C. quinquefasciatus |
CPIJ006975 |
| A. gambiae |
AGAP001823 |
| A. aegypti |
AAEL012819 |
| P. vanderplanki |
Pv.13553 |